Stem-loop sequence ipu-mir-181a-5

AccessionMI0024530 (change log)
DescriptionIctalurus punctatus miR-181a-5 stem-loop
Gene family MIPF0000007; mir-181
Literature search

1 open access papers mention ipu-mir-181a-5
(5 sentences)

Stem-loop
   --a           ug      a    gcaa 
5'    acauucaacgc  ucggug guuu    g
      |||||||||||  |||||| ||||    u
3'    ugugaguugug  agcuac caaa    g
   cca           --      -    aaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-181a

Accession MIMAT0029436
Sequence

1 - 

aacauucaacgcugucggugag

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1