Stem-loop sequence ipu-mir-181a-3

AccessionMI0024528 (change log)
DescriptionIctalurus punctatus miR-181a-3 stem-loop
Gene family MIPF0000007; mir-181
Literature search

1 open access papers mention ipu-mir-181a-3
(5 sentences)

Stem-loop
   --a   u      cu       a     aga 
5'    aca ucaacg  gucggug guuuu   c
      ||| ||||||  ||||||| |||||   a
3'    ugu aguugc  cagcuac caaaa   u
   ccg   c      --       -     agu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-181a

Accession MIMAT0029436
Sequence

1 - 

aacauucaacgcugucggugag

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1