Stem-loop sequence ipu-mir-181a-1

AccessionMI0024526 (change log)
DescriptionIctalurus punctatus miR-181a-1 stem-loop
Gene family MIPF0000007; mir-181
Literature search

1 open access papers mention ipu-mir-181a-1
(5 sentences)

Stem-loop
   --a   u      cu       a    -gag  a 
5'    aca ucaacg  gucggug guuu    cu a
      ||| ||||||  ||||||| ||||    ||  
3'    ugu aguugc  cagcuac caaa    gg a
   cca   u      --       -    aaaa  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-181a

Accession MIMAT0029436
Sequence

1 - 

aacauucaacgcugucggugag

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1