Stem-loop sequence ipu-mir-17b

AccessionMI0024525 (change log)
DescriptionIctalurus punctatus miR-17b stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   ---ca        a  g     g   uuca 
5'      aagugcuu ca ugcag uag    a
        |||||||| || ||||| |||    u
3'      uucacgga gu acguc auc    a
   cgaac        g  g     -   uaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-17b

Accession MIMAT0029435
Sequence

37 - 

acugcaguggaggcacuucaagc

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1