Stem-loop sequence ipu-mir-17a

AccessionMI0024524 (change log)
DescriptionIctalurus punctatus miR-17a stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   --ca        a  g     g   -    a 
5'     aagugcuu ca ugcag uag uauu u
       |||||||| || ||||| ||| ||||  
3'     uucacgga gu acguc auc auaa g
   gauc        g  g     -   u    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-17a

Accession MIMAT0029434
Sequence

39 - 

acugcaguggaggcacuucuag

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1