Stem-loop sequence ipu-mir-16b

AccessionMI0024522 (change log)
DescriptionIctalurus punctatus miR-16b stem-loop
Gene family MIPF0000006; mir-15
Literature search

1 open access papers mention ipu-mir-16b
(2 sentences)

Stem-loop
   u         -ua          ucaaa  a 
5'  agcagcacg   aauauuggag     gc c
    |||||||||   ||||||||||     ||  
3'  ucgucgugc   uuaugaccuc     cg u
   -         cag          cuaag  u 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-16b

Accession MIMAT0029432
Sequence

1 - 

uagcagcacguaaauauuggag

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1