Stem-loop sequence ipu-mir-15b

AccessionMI0024521 (change log)
DescriptionIctalurus punctatus miR-15b stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   --ua                  u  ---   a 
5'     gcagcacaucaugguuug aa   guu u
       |||||||||||||||||| ||   ||| a
3'     ugucguguaguacuaagc uu   cgg a
   ucac                  c  aaa   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-15b

Accession MIMAT0029431
Sequence

1 - 

uagcagcacaucaugguuugua

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1