Stem-loop sequence ipu-mir-15a-2

AccessionMI0024520 (change log)
DescriptionIctalurus punctatus miR-15a-2 stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   --ua        ga          gugau 
5'     gcagcaca  augguuugug     a
       ||||||||  ||||||||||      
3'     cgucgugu  uaccggacgu     c
   acga        ag          agaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-15a

Accession MIMAT0029430
Sequence

1 - 

uagcagcacagaaugguuugu

 - 21

Get sequence
Evidence experimental; Illumina [1]

References

1