Stem-loop sequence ipu-mir-15a-1

AccessionMI0024519 (change log)
DescriptionIctalurus punctatus miR-15a-1 stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   -ua         a          ag  au 
5'    gcagcacag augguuugug  uu  a
      ||||||||| ||||||||||  ||   
3'    cgucguguc ugccggacgu  gg  a
   cgg         a          gg  gc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-15a

Accession MIMAT0029430
Sequence

1 - 

uagcagcacagaaugguuugu

 - 21

Get sequence
Evidence experimental; Illumina [1]

References

1