Stem-loop sequence ipu-mir-146b

AccessionMI0024513 (change log)
DescriptionIctalurus punctatus miR-146b stem-loop
Gene family MIPF0000103; mir-146
Stem-loop
   --               aa    gucugcu 
5'   ugagaacugaauucc  gggu       u
     |||||||||||||||  ||||        
3'   auucuugacuugagg  cccg       u
   ga               ca    acuuaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-146b

Accession MIMAT0029424
Sequence

1 - 

ugagaacugaauuccaagggug

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1