Stem-loop sequence ipu-mir-146a

AccessionMI0024512 (change log)
DescriptionIctalurus punctatus miR-146a stem-loop
Gene family MIPF0000103; mir-146
Stem-loop
   u         au           uguuca 
5'  gagaacuga  uccauagaugg      u
    |||||||||  |||||||||||       
3'  uucuugacu  ggguaucuacu      g
   -         -c           ugaaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-146a

Accession MIMAT0029423
Sequence

1 - 

ugagaacugaauuccauagaugg

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1