Stem-loop sequence ipu-mir-144

AccessionMI0024510 (change log)
DescriptionIctalurus punctatus miR-144 stem-loop
Gene family MIPF0000093; mir-144
Literature search

1 open access papers mention ipu-mir-144
(3 sentences)

Stem-loop
   -gg        g         --ag    u 
5'    auaucauc uauacugua    uuca u
      |||||||| |||||||||    ||||  
3'    uguaguag auaugacau    gagu a
   uca        -         caca    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-144

Accession MIMAT0029421
Sequence

38 - 

cuacaguauagaugauguacu

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1