Stem-loop sequence ipu-mir-1388

AccessionMI0024503 (change log)
DescriptionIctalurus punctatus miR-1388 stem-loop
Gene family MIPF0000805; mir-1388
Literature search

1 open access papers mention ipu-mir-1388
(1 sentences)

Stem-loop
   ---a  a   u c         a  -  uga 
5'     gg cug c aaccugaga ug cu   g
       || ||| | ||||||||| || ||    
3'     cc gac g uuggacucu ac gg   u
   agua  c   u c         a  u  uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-1388

Accession MIMAT0029415
Sequence

38 - 

aucucagguucgucagcccauga

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1