Stem-loop sequence ipu-mir-135b

AccessionMI0024497 (change log)
DescriptionIctalurus punctatus miR-135b stem-loop
Gene family MIPF0000028; mir-135
Stem-loop
   --          u        c    aa  g 
5'   uauggcuuuu auuccuau ugag  uu c
     |||||||||| |||||||| ||||  ||  
3'   guaccgaagg uagggaua acuc  ga u
   ac          -        u    ag  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-135b

Accession MIMAT0029411
Sequence

1 - 

uauggcuuuuuauuccuaucug

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1