Stem-loop sequence ipu-mir-122

AccessionMI0024469 (change log)
DescriptionIctalurus punctatus miR-122 stem-loop
Gene family MIPF0000095; mir-122
Stem-loop
   ugg       c           -uau a 
5'    aguguga aaugguguuug    c u
      ||||||| |||||||||||    |  
3'    ucacacu uuaccgcaaac    g c
   --a       a           ugcu u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-122

Accession MIMAT0029395
Sequence

1 - 

uggagugugacaaugguguuu

 - 21

Get sequence
Evidence experimental; Illumina [1]

References

1