Stem-loop sequence ipu-let-7j-2

AccessionMI0024454 (change log)
DescriptionIctalurus punctatus let-7j-2 stem-loop
Literature search

1 open access papers mention ipu-let-7j-2
(5 sentences)

Stem-loop
   --     --u ug    uuuau     -   g 
5'   uugug   a  gcug     ccuug ccu u
     |||||   |  ||||     ||||| ||| u
3'   gacau   u  ugau     ggagu ggg c
   uu     guu gu    -----     u   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-let-7j

Accession MIMAT0029383
Sequence

36 - 

ugagguaguuguuuguacaguu

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1