Stem-loop sequence ipu-let-7e-2

AccessionMI0024446 (change log)
DescriptionIctalurus punctatus let-7e-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention ipu-let-7e-2
(5 sentences)

Stem-loop
   --u   gu         a        -------    uau 
5'    gag  aguagauug auaguugu       ggag   a
      |||  ||||||||| ||||||||       ||||    
3'    uuc  ucaucuaac uaucaaua       ccuc   a
   ucu   ug         a        gaguuuc    caa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-let-7e

Accession MIMAT0029378
Sequence

1 - 

ugagguaguagauugaauaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1