Stem-loop sequence aja-mir-144

AccessionMI0024359 (change log)
DescriptionArtibeus jamaicensis miR-144 stem-loop
Gene family MIPF0000093; mir-144
Stem-loop
   ---  -    u      g        a         -a    gc 
5'    gg gccc ggcugg auaucauc uauacugua  guuu  a
      || |||| |||||| |||||||| |||||||||  ||||   
3'    cc cggg cugauc uguaguag auaugacau  caga  a
   ccc  a    c      a        -         ca    gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence aja-miR-144

Accession MIMAT0031137
Sequence

50 - 

uacaguauagaugauguacu

 - 69

Get sequence
Evidence not experimental

References

1
PMID:23166587 "Transcriptome sequencing and annotation for the Jamaican fruit bat (Artibeus jamaicensis)" Shaw TI, Srivastava A, Chou WC, Liu L, Hawkinson A, Glenn TC, Adams R, Schountz T PLoS One. 7:e48472(2012).