Stem-loop sequence aja-mir-29b

AccessionMI0024357 (change log)
DescriptionArtibeus jamaicensis miR-29b stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
            -          c      g  u    uuuucc 
5' cuucuggaa gcugguuuca auggug cu agau      a
   ||||||||| |||||||||| |||||| || ||||       
3' gaggauuuu ugacuaaagu uaccac ga ucua      u
            g          u      -  -    uguuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence aja-miR-29b

Accession MIMAT0031135
Sequence

52 - 

uagcaccauuugaaaucaguguu

 - 74

Get sequence
Evidence not experimental

References

1
PMID:23166587 "Transcriptome sequencing and annotation for the Jamaican fruit bat (Artibeus jamaicensis)" Shaw TI, Srivastava A, Chou WC, Liu L, Hawkinson A, Glenn TC, Adams R, Schountz T PLoS One. 7:e48472(2012).