Stem-loop sequence sly-MIR168a

AccessionMI0024352 (change log)
DescriptionSolanum lycopersicum miR168a stem-loop
Gene family MIPF0000081; MIR168
Literature search

20 open access papers mention sly-MIR168a
(68 sentences)

Stem-loop
       u     c          u        --ca       gcgccgggaauaaugccggacgaacgacggcgguguua 
5' cucu auucg uuggugcagg cgggaccu    uucgccg                                      a
   |||| ||||| |||||||||| ||||||||    |||||||                                      u
3' gagg uaagu aacuacguuc guccuggg    aagcggc                                      u
       u     c          c        uuua       gauuaguuuguagauaggcagccacugucgaaaucauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr8: 558753-558911 [+]
intergenic
Database links

Mature sequence sly-miR168a-5p

Accession MIMAT0031129
Sequence

8 - 

ucgcuuggugcaggucgggac

 - 28

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sly-miR168a-3p

Accession MIMAT0031130
Sequence

134 - 

ccugccuugcaucaacugaau

 - 154

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23080016 "The developmental outcomes of P0-mediated ARGONAUTE destabilization in tomato" Hendelman A, Kravchik M, Stav R, Zik M, Lugassi N, Arazi T Planta. 237:363-377(2013).