Stem-loop sequence mes-MIR828b

AccessionMI0024346 (change log)
DescriptionManihot esculenta miR828b stem-loop
Gene family MIPF0000544; MIR828
Literature search

3 open access papers mention mes-MIR828b
(6 sentences)

Stem-loop
       uc   a g     c      uc            cacaaucuucuuagaggaagacauaauuuuccacuuaaacgucguuuc 
5' cccu  cau g aaggc ucuugc  aaaugaguauuc                                                a
   ||||  ||| | ||||| ||||||  ||||||||||||                                                a
3' ggga  gua c uuucg agaacg  uuuacucauagg                                                u
       ga   - g     u      ga            uaagguugacaaucucucugacugaugacuuucuuuacuuccauuuga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold03581: 479735-479908 [-]
intergenic
Database links

Mature sequence mes-miR828b

Accession MIMAT0029304
Sequence

19 - 

ucuugcucaaaugaguauucca

 - 40

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).