Stem-loop sequence mes-MIR535b

AccessionMI0024343 (change log)
DescriptionManihot esculenta miR535b stem-loop
Gene family MIPF0000136; MIR535
Literature search

4 open access papers mention mes-MIR535b
(9 sentences)

Stem-loop
          -   ca   -gu         g   g      g    c    uu     - a 
5' gcuuuga cau  uuc   ugacaacga aga agcacg uugu agca  ucaug c a
   ||||||| |||  |||   ||||||||| ||| |||||| |||| ||||  ||||| |  
3' cgagacu gug  aag   acuguugcu ucu ucgugc aaca uugu  aguac g g
          c   --   aau         a   g      g    u    -c     a g 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold01190: 166527-166640 [-]
intergenic
Clustered miRNAs
< 10kb from mes-MIR535b
mes-MIR535bscaffold01190: 166527-166640 [-]
mes-MIR535dscaffold01190: 159468-159600 [-]
Database links

Mature sequence mes-miR535b

Accession MIMAT0029301
Sequence

18 - 

ugacaacgagagagagcacgg

 - 38

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).