Stem-loop sequence mes-MIR535a

AccessionMI0024342 (change log)
DescriptionManihot esculenta miR535a stem-loop
Gene family MIPF0000136; MIR535
Literature search

4 open access papers mention mes-MIR535a
(8 sentences)

Stem-loop
          -   u   ggu         g  a            c    uu ug  uu 
5' gcuuuga cau auu   ugacaacga ag gagcacguuugu agca  u  ug  a
   ||||||| ||| |||   ||||||||| || |||||||||||| ||||  |  ||  g
3' cgaaacu gug uaa   acuguugcu uc cucgugcgaaca uugu  a  ac  g
          c   -   -au         a  c            u    -c gu  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold05782: 22903-23015 [-]
intergenic
Database links

Mature sequence mes-miR535a

Accession MIMAT0029300
Sequence

18 - 

ugacaacgagagagagcacgu

 - 38

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).