Stem-loop sequence mes-MIR399g

AccessionMI0024327 (change log)
DescriptionManihot esculenta miR399g stem-loop
Gene family MIPF0000015; MIR399
Literature search

6 open access papers mention mes-MIR399g
(8 sentences)

Stem-loop
   ca       ac    a        c   c      agauucucuaucc 
5'   gggcaaa  cucc uuggcaug agc acacua             u
     |||||||  |||| |||||||| ||| ||||||             u
3'   cccguuu  gagg aaccguac ucg ugugau             g
   gg       -a    a        c   -      auccuuacguguu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold04003: 23587-23683 [-]
intergenic
Database links

Mature sequence mes-miR399g

Accession MIMAT0029285
Sequence

77 - 

ugccaaaggagauuugcccgg

 - 97

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).