Stem-loop sequence mes-MIR399f

AccessionMI0024326 (change log)
DescriptionManihot esculenta miR399f stem-loop
Gene family MIPF0000015; MIR399
Literature search

6 open access papers mention mes-MIR399f
(8 sentences)

Stem-loop
                c     gc         -  uuaaugggauaccaau 
5' cggucgcagggca cucuc  uuggcaggu ac                a
   ||||||||||||| |||||  ||||||||| ||                u
3' guuagugucccgu gagag  aaccguuca ug                u
                u     ga         g  cuaacucuacucuagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold11425: 531795-531894 [+]
intergenic
Clustered miRNAs
< 10kb from mes-MIR399f
mes-MIR399hscaffold11425: 529448-529551 [+]
mes-MIR399fscaffold11425: 531795-531894 [+]
Database links

Mature sequence mes-miR399f

Accession MIMAT0029284
Sequence

74 - 

ugccaaaggagaguugcccug

 - 94

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).