Stem-loop sequence mes-MIR399e

AccessionMI0024325 (change log)
DescriptionManihot esculenta miR399e stem-loop
Gene family MIPF0000015; MIR399
Literature search

6 open access papers mention mes-MIR399e
(8 sentences)

Stem-loop
   ca     a       a        c   cacuuaua       u   cu 
5'   gggca gaucucc uuggcagg agc        aaacuaa aug  u
     ||||| ||||||| |||||||| |||        ||||||| |||  u
3'   cucgu uuagagg aaccgucu ucg        uuugauu ugc  c
   gg     -       a        c   --------       u   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold10535: 4988-5079 [+]
intergenic
Clustered miRNAs
< 10kb from mes-MIR399e
mes-MIR399bscaffold10535: 2315-2406 [-]
mes-MIR399escaffold10535: 4988-5079 [+]
mes-MIR399cscaffold10535: 11452-11543 [+]
mes-MIR399dscaffold10535: 13795-13886 [+]
Database links

Mature sequence mes-miR399e

Accession MIMAT0029283
Sequence

72 - 

ugccaaaggagauuugcucgg

 - 92

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).