Stem-loop sequence mes-MIR399d

AccessionMI0024324 (change log)
DescriptionManihot esculenta miR399d stem-loop
Gene family MIPF0000015; MIR399
Literature search

6 open access papers mention mes-MIR399d
(10 sentences)

Stem-loop
   ca       c     a        c   cacuuac     c    u 
5'   ggguaaa ucucc uuggcagg agc       agaau aaua g
     ||||||| ||||| |||||||| |||       ||||| |||| c
3'   cccguuu agagg aaccgucu ucg       uuuua uuau a
   gg       -     a        c   --ucuaa     u    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold10535: 13795-13886 [+]
intergenic
Clustered miRNAs
< 10kb from mes-MIR399d
mes-MIR399escaffold10535: 4988-5079 [+]
mes-MIR399cscaffold10535: 11452-11543 [+]
mes-MIR399dscaffold10535: 13795-13886 [+]
Database links

Mature sequence mes-miR399d

Accession MIMAT0029282
Sequence

72 - 

ugccaaaggagauuugcccgg

 - 92

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).