Stem-loop sequence mes-MIR399c

AccessionMI0024323 (change log)
DescriptionManihot esculenta miR399c stem-loop
Gene family MIPF0000015; MIR399
Literature search

7 open access papers mention mes-MIR399c
(9 sentences)

Stem-loop
   ca       c     a        ca  -    uaca       uuug 
5'   ggguaaa ucucc uuggcagg  gc cacu    gaacuaa    c
     ||||||| ||||| ||||||||  || ||||    |||||||     
3'   cccguuu agagg aaccgucu  cg guga    uuugguu    a
   gg       -     a        cc  u    ----       uguu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold10535: 11452-11543 [+]
intergenic
Clustered miRNAs
< 10kb from mes-MIR399c
mes-MIR399bscaffold10535: 2315-2406 [-]
mes-MIR399escaffold10535: 4988-5079 [+]
mes-MIR399cscaffold10535: 11452-11543 [+]
mes-MIR399dscaffold10535: 13795-13886 [+]
Database links

Mature sequence mes-miR399c

Accession MIMAT0029281
Sequence

72 - 

ugccaaaggagauuugcccgg

 - 92

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).