Stem-loop sequence mes-MIR399b

AccessionMI0024322 (change log)
DescriptionManihot esculenta miR399b stem-loop
Gene family MIPF0000015; MIR399
Literature search

6 open access papers mention mes-MIR399b
(8 sentences)

Stem-loop
   ca       c     a        c   -    --u     ac    u 
5'   ggguaaa ucucc uuggcagg agc cacu   acaga  uaau u
     ||||||| ||||| |||||||| ||| ||||   |||||  ||||  
3'   cccguuu agagg aaccgucu ucg guga   uguuu  auua g
   gg       -     a        c   u    uuu     --    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold10535: 2315-2406 [-]
intergenic
Clustered miRNAs
< 10kb from mes-MIR399b
mes-MIR399cscaffold10535: 11452-11543 [+]
mes-MIR399escaffold10535: 4988-5079 [+]
mes-MIR399bscaffold10535: 2315-2406 [-]
Database links

Mature sequence mes-miR399b

Accession MIMAT0029280
Sequence

72 - 

ugccaaaggagauuugcccgg

 - 92

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).