Stem-loop sequence gga-mir-7483

AccessionMI0024163 (change log)
DescriptionGallus gallus miR-7483 stem-loop
Stem-loop
   --  augg     ug  -gca     a  u 
5'   gc    uguag  ac    ggcag gc a
     ||    |||||  ||    ||||| ||  
3'   cg    acguc  ug    ccguc cg u
   aa  --ga     ca  aaua     c  g 
Get sequence
Deep sequencing
769 reads, 400 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chrZ: 81533138-81533194 [-]
intergenic
Database links

Mature sequence gga-miR-7483-5p

Accession MIMAT0029120
Sequence

1 - 

gcaugguguagugacgcaggcag

 - 23

Get sequence
Deep sequencing768 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7483-3p

Accession MIMAT0029121
Sequence

36 - 

gccauaaguaccugcaaggcaa

 - 57

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).