Stem-loop sequence gga-mir-7482-1

AccessionMI0024162 (change log)
Previous IDsgga-mir-7482
DescriptionGallus gallus miR-7482-1 stem-loop
Gene family MIPF0001894; mir-7482
Stem-loop
   c  -g       ucac  ac       g 
5'  cu  ggcuugu    uc  cagagag g
    ||  |||||||    ||  ||||||| c
3'  ga  ccgaaca    ag  gucuuuc a
   a  ga       -cac  ac       a 
Get sequence
Deep sequencing
64 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chrZ: 34300480-34300536 [+]
antisense
Database links

Mature sequence gga-miR-7482-5p

Accession MIMAT0029118
Sequence

1 - 

ccugggcuuguucacucaccagaga

 - 25

Get sequence
Deep sequencing120 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence gga-miR-7482-3p

Accession MIMAT0029119
Sequence

35 - 

ucugcagacacacaagccagaga

 - 57

Get sequence
Deep sequencing252 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).