Stem-loop sequence gga-mir-7481

AccessionMI0024161 (change log)
DescriptionGallus gallus miR-7481 stem-loop
Stem-loop
   -       gua   g    - aa   a 
5'  cuuuccu   gga ccag g  gaa g
    |||||||   ||| |||| |  ||| a
3'  ggaaggg   ucu gguc c  cuu c
   a       --g   -    u ga   a 
Get sequence
Deep sequencing
502 reads, 100 reads per million, 1 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chrZ: 64304208-64304259 [+]
intergenic
Database links

Mature sequence gga-miR-7481-5p

Accession MIMAT0029116
Sequence

1 - 

cuuuccuguaggagccaggaaga

 - 23

Get sequence
Deep sequencing43 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7481-3p

Accession MIMAT0029117
Sequence

30 - 

uucagcucuggucuggggaagga

 - 52

Get sequence
Deep sequencing455 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).