Stem-loop sequence gga-mir-7480-1

AccessionMI0024159 (change log)
DescriptionGallus gallus miR-7480-1 stem-loop
Gene family MIPF0001813; mir-7480
Stem-loop
   -u    aa  a a  ga  -    c   a 
5'   ucug  cg g cu  ag gaag agc a
     ||||  || | ||  || |||| |||  
3'   agac  gu c ga  uc cuuc ucg u
   ac    ag  g -  aa  u    -   u 
Get sequence
Deep sequencing
2122 reads, 300 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
AADN04003222.1: 15293-15348 [-]
intergenic
Database links

Mature sequence gga-miR-7480-5p

Accession MIMAT0029114
Sequence

1 - 

uucugaacgagacugaaggaagc

 - 23

Get sequence
Deep sequencing6357 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence gga-miR-7480-3p

Accession MIMAT0029115
Sequence

35 - 

uucucuaaagcguggacagaca

 - 56

Get sequence
Deep sequencing9 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).