Stem-loop sequence gga-mir-7479-3

AccessionMI0024158 (change log)
DescriptionGallus gallus miR-7479-3 stem-loop
Gene family MIPF0001699; mir-7479
Stem-loop
   --    --aa   -  g      u   -aaaaa      cu 
5'   uagu    gca ga auuugc aag      acagug  u
     ||||    ||| || |||||| |||      ||||||   
3'   guca    ugu cu uagaug uuc      ugucau  g
   cg    guac   a  g      u   cgaugg      ca 
Get sequence
Deep sequencing
132 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chrZ: 60825836-60825913 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-7479-3
gga-mir-7479-3chrZ: 60825836-60825913 [-]
gga-mir-7479-2chrZ: 60816939-60817016 [-]
Database links

Mature sequence gga-miR-7479-5p

Accession MIMAT0029112
Sequence

1 - 

uaguaagcagagauuugcua

 - 20

Get sequence
Deep sequencing6 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7479-3p

Accession MIMAT0029113
Sequence

56 - 

guagaugucaugucaugacuggc

 - 78

Get sequence
Deep sequencing333 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).