Stem-loop sequence gga-mir-7478

AccessionMI0024151 (change log)
DescriptionGallus gallus miR-7478 stem-loop
Stem-loop
   --       guga     g --g     a    aaa     a g 
5'   uaccugu    cugug a   aggau ugag   guggg u g
     |||||||    ||||| |   ||||| ||||   ||||| |  
3'   guggacg    ggcac u   uccug acuc   caccc a a
   ga       ----     g aca     -    ---     a a 
Get sequence
Deep sequencing
625 reads, 33.3 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
AADN04000787.1: 986-1063 [-]
intergenic
AADN04001013.1: 28464-28541 [-]
intergenic
AADN04001058.1: 20409-20486 [-]
intergenic
AADN04001184.1: 24105-24182 [-]
intergenic
AADN04001195.1: 17049-17126 [+]
intergenic
AADN04001464.1: 9669-9746 [+]
intergenic
AADN04001515.1: 12870-12947 [+]
intergenic
AADN04001825.1: 10860-10937 [-]
intergenic
AADN04001939.1: 14590-14667 [-]
intergenic
AADN04002188.1: 4521-4598 [-]
intergenic
AADN04002235.1: 14892-14969 [-]
intergenic
AADN04002674.1: 12847-12924 [+]
intergenic
AADN04002678.1: 5898-5975 [-]
intergenic
AADN04003570.1: 12507-12584 [+]
intergenic
AADN04007859.1: 3474-3551 [+]
intergenic
AADN04009770.1: 3891-3968 [+]
intergenic
AADN04012884.1: 6060-6137 [+]
intergenic
AADN04016299.1: 4875-4952 [-]
intergenic
KQ759544.1: 1097-1174 [-]
intergenic
Database links

Mature sequence gga-miR-7478-5p

Accession MIMAT0029110
Sequence

1 - 

uaccugugugacuguggagagga

 - 23

Get sequence
Deep sequencing498 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7478-3p

Accession MIMAT0029111
Sequence

58 - 

cuacaugcacgggcaggugag

 - 78

Get sequence
Deep sequencing6 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).