Stem-loop sequence gga-mir-7477

AccessionMI0024150 (change log)
DescriptionGallus gallus miR-7477 stem-loop
Literature search

1 open access papers mention gga-mir-7477
(2 sentences)

Stem-loop
   -a -        u      u  -    u  ag 
5'   c agcgcgga cggggc gg gagc gc  g
     | |||||||| |||||| || |||| ||   
3'   g ucgcgucu gccccg cc uucg cg  a
   ag c        u      -  a    c  cg 
Get sequence
Deep sequencing
36 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr33: 874767-874828 [-]
intergenic
Database links

Mature sequence gga-miR-7477-5p

Accession MIMAT0029108
Sequence

1 - 

acagcgcggaucggggcugggag

 - 23

Get sequence
Deep sequencing16 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7477-3p

Accession MIMAT0029109
Sequence

40 - 

uaccgccccguucugcgcucgga

 - 62

Get sequence
Deep sequencing19 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).