Stem-loop sequence gga-mir-7476

AccessionMI0024149 (change log)
DescriptionGallus gallus miR-7476 stem-loop
Stem-loop
   --uc        u   a       --c   gca 
5'     uuagcuca cug ugugaag   ugu   a
       |||||||| ||| |||||||   |||    
3'     agucgggu gac acacuuu   aua   g
   cgua        -   a       uua   aaa 
Get sequence
Deep sequencing
23 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr15: 5022044-5022106 [+]
sense
ENSGALT00000005250 ; gga-mir-7476-201; exon 7
Database links

Mature sequence gga-miR-7476-5p

Accession MIMAT0029106
Sequence

1 - 

ucuuagcucaucugaugugaag

 - 22

Get sequence
Deep sequencing19 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7476-3p

Accession MIMAT0029107
Sequence

43 - 

ucacaacagugggcugaaugc

 - 63

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).