Stem-loop sequence gga-mir-7475

AccessionMI0024148 (change log)
DescriptionGallus gallus miR-7475 stem-loop
Stem-loop
   -    - g     g     -   g   c   gcc 
5'  ccgc c ccgcc cgccc ucc cac gcg   g
    |||| | ||||| ||||| ||| ||| |||    
3'  ggcg g ggugg gcggg agg gug cgc   g
   u    c -     -     c   a   u   gac 
Get sequence
Deep sequencing
75 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence does not map exactly to the galGal4.0 chicken genome assembly, but is annotated based on a Trace Achive sequence (tuj76a09_t167e167.b2).

Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr9: 3662052-3662116 [+]
intergenic
Database links

Mature sequence gga-miR-7475-5p

Accession MIMAT0029104
Sequence

1 - 

ccgccgccgccgcgcccucc

 - 20

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7475-3p

Accession MIMAT0029105
Sequence

47 - 

acgggcgggugggcgcggu

 - 65

Get sequence
Deep sequencing43 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).