Stem-loop sequence gga-mir-7474

AccessionMI0024147 (change log)
DescriptionGallus gallus miR-7474 stem-loop
Stem-loop
   --gua      u  u       ---    aucug   --  g 
5'      cggagu gg gaaccac   ugga     uuc  ca u
        |||||| || |||||||   ||||     |||  ||  
3'      gccuca uc cuuggug   accu     aag  gu a
   aaacc      -  -       uuu    --aaa   ua  a 
Get sequence
Deep sequencing
48 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr7: 15412869-15412943 [+]
sense
ENSGALT00000043948 ; gga-mir-7474-201; 3'UTR (exon 234)
Database links

Mature sequence gga-miR-7474-5p

Accession MIMAT0029102
Sequence

1 - 

guacggaguuggugaaccacugg

 - 23

Get sequence
Deep sequencing32 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7474-3p

Accession MIMAT0029103
Sequence

52 - 

auuugugguuccuacuccgccaaa

 - 75

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).