Stem-loop sequence gga-mir-7473

AccessionMI0024146 (change log)
DescriptionGallus gallus miR-7473 stem-loop
Stem-loop
   --a          a   g   c      uaa 
5'    agagauuuac ugc uaa ucccau   c
      |||||||||| ||| ||| ||||||    
3'    ucucuaaaug acg auu agggua   u
   ugc          c   g   c      uuc 
Get sequence
Deep sequencing
20 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr7: 33572495-33572556 [+]
antisense
ENSGALT00000020339 ; ZEB2-201; intron 1
Database links

Mature sequence gga-miR-7473-5p

Accession MIMAT0029100
Sequence

1 - 

aagagauuuacaugcguaacucc

 - 23

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7473-3p

Accession MIMAT0029101
Sequence

40 - 

acuuaggcacguaaaucucucgu

 - 62

Get sequence
Deep sequencing20 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).