Stem-loop sequence gga-mir-7472

AccessionMI0024145 (change log)
DescriptionGallus gallus miR-7472 stem-loop
Stem-loop
   ---au   c      u  a    g  cuccuc 
5'      gug uggaga ga gcug ag      u
        ||| |||||| || |||| ||      c
3'      cac accucu cu cgac uc      c
   cgucu   u      c  -    g  ucacua 
Get sequence
Deep sequencing
420 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr6: 30088763-30088825 [+]
sense
ENSGALT00000015315 ; GRK5-201; intron 1
Database links

Mature sequence gga-miR-7472-5p

Accession MIMAT0029098
Sequence

1 - 

augugcuggagaugaagcugga

 - 22

Get sequence
Deep sequencing417 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7472-3p

Accession MIMAT0029099
Sequence

42 - 

cagcuccucuccaucacucugc

 - 63

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).