Stem-loop sequence gga-mir-7471

AccessionMI0024144 (change log)
DescriptionGallus gallus miR-7471 stem-loop
Literature search

1 open access papers mention gga-mir-7471
(1 sentences)

Stem-loop
   --   --  ug    g      c  u    cg 
5'   guc  gg  ccgu cggggc gu gugg  c
     |||  ||  |||| |||||| || ||||   
3'   cgg  uc  ggcg gcccug cg cgcc  c
   gg   ug  gu    a      -  -    uu 
Get sequence
Deep sequencing
90 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr14: 14339056-14339115 [-]
intergenic
AADN04000668.1: 9292-9351 [-]
intergenic
Database links

Mature sequence gga-miR-7471-5p

Accession MIMAT0029096
Sequence

1 - 

gucggugccgugcggggc

 - 18

Get sequence
Deep sequencing55 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7471-3p

Accession MIMAT0029097
Sequence

41 - 

cccgagcggugcuguggcgg

 - 60

Get sequence
Deep sequencing35 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).