Stem-loop sequence gga-mir-7470

AccessionMI0024143 (change log)
DescriptionGallus gallus miR-7470 stem-loop
Stem-loop
   ---   ga        a   u         a aa 
5'    ugu  ucuugaag acg gggccuggc c  a
      |||  |||||||| ||| ||||||||| |   
3'    acg  aggauuuc ugu cccggaucg g  g
   aaa   ag        g   c         a ac 
Get sequence
Deep sequencing
1065 reads, 200 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr5: 55010406-55010472 [-]
intergenic
chr5: 55038475-55038541 [-]
intergenic
chr5: 55048553-55048619 [-]
intergenic
chr5: 55066228-55066294 [-]
intergenic
AADN04001900.1: 7872-7938 [-]
intergenic
AADN04001900.1: 21272-21338 [-]
intergenic
AADN04001907.1: 6595-6661 [-]
intergenic
AADN04001907.1: 19977-20043 [-]
intergenic
Database links

Mature sequence gga-miR-7470-5p

Accession MIMAT0029094
Sequence

1 - 

ugugaucuugaagaacgugggc

 - 22

Get sequence
Deep sequencing842 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7470-3p

Accession MIMAT0029095
Sequence

45 - 

cccugugcuuuaggagagcaaaa

 - 67

Get sequence
Deep sequencing99 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).