Stem-loop sequence gga-mir-7468

AccessionMI0024141 (change log)
DescriptionGallus gallus miR-7468 stem-loop
Stem-loop
   --   - a    uc   g    u   a  a   g 
5'   ucu c cagc  cuu cauu agc gc cau g
     ||| | ||||  ||| |||| ||| || |||  
3'   gga g guug  gaa guag ucg ug gug g
   cc   c a    ua   g    u   a  g   u 
Get sequence
Deep sequencing
692 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 55084392-55084458 [-]
intergenic
Database links

Mature sequence gga-miR-7468-5p

Accession MIMAT0029090
Sequence

1 - 

ucucacagcuccuugcauuuag

 - 22

Get sequence
Deep sequencing10 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7468-3p

Accession MIMAT0029091
Sequence

45 - 

ugauggaagauguugagcaggcc

 - 67

Get sequence
Deep sequencing668 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).