Stem-loop sequence gga-mir-7467

AccessionMI0024140 (change log)
DescriptionGallus gallus miR-7467 stem-loop
Stem-loop
   --gc     c      ga     ccu  u   g 
5'     cagcg gguggu  uggug   gg aug c
       ||||| ||||||  |||||   || |||  
3'     gucgc ccaccg  accac   cc uac u
   cgca     a      ac     --c  -   g 
Get sequence
Deep sequencing
27 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 83395402-83395464 [+]
intergenic
Database links

Mature sequence gga-miR-7467-5p

Accession MIMAT0029088
Sequence

1 - 

gccagcgcgguggugauggugcc

 - 23

Get sequence
Deep sequencing9 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7467-3p

Accession MIMAT0029089
Sequence

41 - 

caccacagccaccacgcugacgc

 - 63

Get sequence
Deep sequencing18 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).