Stem-loop sequence gga-mir-7466

AccessionMI0024139 (change log)
DescriptionGallus gallus miR-7466 stem-loop
Stem-loop
   -------------------------    cca     
5'                          cugg   cucu 
                            ||||   ||| g
3'                          gacc   gagg 
   gaggacgaaggagauguccuuuuac    ucg     
Get sequence
Deep sequencing
338 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 58512315-58512362 [+]
sense
ENSGALT00000019895 ; PLA2G12A-201; intron 4
Database links

Mature sequence gga-miR-7466-5p

Accession MIMAT0029086
Sequence

1 - 

cuggccacucugggaggcuc

 - 20

Get sequence
Deep sequencing4 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7466-3p

Accession MIMAT0029087
Sequence

26 - 

uuuuccuguagaggaagcaggag

 - 48

Get sequence
Deep sequencing335 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).