Stem-loop sequence gga-mir-7465

AccessionMI0024138 (change log)
DescriptionGallus gallus miR-7465 stem-loop
Stem-loop
   --    a    u       cgcuucc 
5'   ucag uagc gauacuc       u
     |||| |||| |||||||       u
3'   aguc auug cugugag       a
   cc    c    u       acuuauu 
Get sequence
Deep sequencing
104 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 81847762-81847814 [-]
sense
ENSGALT00000025678 ; KCNQ5-201; intron 11
Database links

Mature sequence gga-miR-7465-5p

Accession MIMAT0029084
Sequence

1 - 

ucagauagcugauacuccgc

 - 20

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7465-3p

Accession MIMAT0029085
Sequence

34 - 

agagugucuguuaccugacc

 - 53

Get sequence
Deep sequencing104 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).