Stem-loop sequence gga-mir-7464

AccessionMI0024137 (change log)
DescriptionGallus gallus miR-7464 stem-loop
Stem-loop
   --                       cu g 
5'   caauggcucagugcagugccguu  g u
     |||||||||||||||||||||||  |  
3'   guuacugagucacgucacgguaa  c g
   cg                       -c a 
Get sequence
Deep sequencing
58 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 16898369-16898425 [+]
sense
ENSGALT00000014913 ; CHGB-201; intron 2
Database links

Mature sequence gga-miR-7464-5p

Accession MIMAT0029082
Sequence

1 - 

caauggcucagugcagugccguu

 - 23

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7464-3p

Accession MIMAT0029083
Sequence

35 - 

uggcacugcacugagucauuggc

 - 57

Get sequence
Deep sequencing58 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).