Stem-loop sequence gga-mir-7463

AccessionMI0024136 (change log)
DescriptionGallus gallus miR-7463 stem-loop
Stem-loop
   --ug      c             cau    u 
5'     agucuc uugaaaguaaugg   guga u
       |||||| |||||||||||||   ||||  
3'     ucaggg aacuuucauuacc   cauu g
   ugaa      u             --c    c 
Get sequence
Deep sequencing
52 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 1046130-1046191 [+]
intergenic
Database links

Mature sequence gga-miR-7463-5p

Accession MIMAT0029080
Sequence

1 - 

ugagucuccuugaaaguaaugg

 - 22

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7463-3p

Accession MIMAT0029081
Sequence

41 - 

auuacuuucaaugggacuaagu

 - 62

Get sequence
Deep sequencing49 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).