Stem-loop sequence gga-mir-7462

AccessionMI0024135 (change log)
DescriptionGallus gallus miR-7462 stem-loop
Stem-loop
   --      c     u      ug a  gc a 
5'   caaccu auuuc agcuuc  g gu  c c
     |||||| ||||| ||||||  | ||  |  
3'   guugga uaaag ucgaag  c cg  g u
   aa      a     u      gu -  aa u 
Get sequence
Deep sequencing
19 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 54305757-54305817 [+]
sense
ENSGALT00000031778 ; REPS1-201; intron 3
Database links

Mature sequence gga-miR-7462-5p

Accession MIMAT0029078
Sequence

1 - 

caaccucauuucuagcuucugg

 - 22

Get sequence
Deep sequencing16 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7462-3p

Accession MIMAT0029079
Sequence

40 - 

ggaagcuugaaauaagguugaa

 - 61

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).